Anticancer Effects of Grape Seed Extract on Human Cancers a Review

  • Journal List
  • Res Pharm Sci
  • v.xv(4); 2020 Aug
  • PMC7714018

Res Pharm Sci. 2020 Aug; 15(4): 390–400.

Anti-proliferative and anti-apoptotic furnishings of grape seed extract on chemo-resistant OVCAR-3 ovarian cancer cells

Mansour Homayoun

ane Department of Anatomical Sciences, School of Medicine, Isfahan University of Medical Sciences, Isfahan, I.R. Iran

Reza Ghasemnezhad Targhi

2 Department of Radiology, Imam Reza Hospital, Mashhad University of Medical Sciences, Mashhad, I.R. Iran

Mitra Soleimani

i Department of Anatomical Sciences, School of Medicine, Isfahan University of Medical Sciences, Isfahan, I.R. Iran

Received 2020 Jun 13; Revised 2020 Jul 31; Accepted 2020 Aug 24.

Abstract

Background and purpose:

Ovarian cancer is the deadliest cancer in women. The main challenge in the inhibition of ovarian cancer cells is chemo-resistance. Seeking to overcome this issue, several strategies have been suggested, including the administration of natural products. Grape seed extract (GSE) is a good source of polyphenols and its anticancer furnishings have been reported by many studies. In this study we aimed to evaluate the furnishings of GSE on OVCAR-3, a chemo-resistant ovarian cancer line.

Experimental approach:

OVCAR-3 cells were treated with GSE (71 μg/mL) for 24 and 48 h. Cell viability and cell apoptosis were measured by MTT and menses cytometry. The real-time polymerase chain reaction was used to determine the expression of genes involved in the cell cycle (PTEN, DACT1, AKT, MTOR, GSK3B, C-MYC, CCND1, and CDK4) and apoptosis (BAX, BCl2, CASP3, 8 and nine). The expression of CASP3 protein was evaluated past the CASP3 analysis.

Findings / Results:

The results showed that handling of OVCAR-three cells with GSE, increased the expression level of PTEN and DACT1 tumor suppressor genes, too as apoptotic genes, CASP3, viii, and 9 (P < 0.001). Also, the induction of tumor suppressor genes expression was associated with an increase in the expression of BAX/BCL2 factor ratio as pro- and anti-apoptotic genes. The expression of the genes involved in the jail cell cycle, CCND1 and CDK4, was inhibited (P < 0.001). The results indicated that GSE induced cell apoptosis in a fourth dimension-dependent manner (P < 0.001). Also, the GSE handling resulted in the CASP3 protein expression (P < 0.001).

Conclusion and implications:

Co-ordinate to the results of this study, GSE may exert anti-tumorigenic furnishings on chemo-resistant OVCAR-three ovarian cancer cells which might exist mediated past the expression of tumor suppressor genes that interact with cell signaling pathways, cell cycle, and cell apoptosis. Hence, the consumption of GSE extract during chemotherapy may overcome part of chemo-resistance in ovarian cancer.

Keywords: Apoptosis, Chemo-resistance, Grape seed extract, Ovarian cancer

INTRODUCTION

Ovarian cancer is the deadliest gynecological cancer. It accounts for ii.v pct of all malignancies amid females (1). The main treatment for ovarian cancer is surgery alongside the utilise of chemotherapy to kill the remaining cancer cells. Notwithstanding, most patients become resistant to chemotherapy drugs such every bit paclitaxel, carboplatin, and cisplatin (two). Appropriately, researchers are seeking strategies to improve chemotherapy responses in ovarian cancer cells (3). The knowledge of medicinal plants has grown over the years, and the use of new medicines to overcome various human diseases has become mutual (4). Several studies indicated that natural products tin can overcome cancer cell drug resistance (5).

Grape seed extract (GSE) has shown anticancer activity in various types of human cancer including chest, prostate, float, lung, and colorectal cancers (vi). GSE is mainly rich in polyphenols such as proanthocyanidins (7).

The anti-proliferation effects of GSE in oral cancer has been reported (viii). Antitumor activeness of GSE is as well were observed in pare cancer (nine). In colorectal cancer, information technology was suggested that GSE affects mitochondrial membrane potential, pro- and anti-apoptotic proteins, and both caspase-dependent/contained apoptotic pathways (ten). Despite known anticancer effects of GSE in some blazon of cancers, the precise machinery of its function in ovarian cancer has not yet been divers.

To evaluate the GSE furnishings on ovarian cancer, we assessed phosphoinositide 3-kinases / protein kinase B / mammalian target of rapamycin (PI3K / Akt / mTOR) that is 1 of the well-nigh investigated intracellular signaling pathway (xi). This pathway is also one of the virtually oft altered intracellular pathways in ovarian cancer and is activated in approximately seventy% of ovarian cancer cases (12). The PI3K/Akt pathway is activated in a different type of cancers and is believed to play a pivotal role in prison cell survival signaling. A key point in Akt regulation is the downwards-regulation of the phosphorylated PI3K.

The phosphorylated form of phosphatase and tensin homologue (PTEN) deleted on chromosome ten is a commuter gene that is involved in this pathway. PTEN is a frequently occurring tumor suppressor associated with ovarian cancer. It negatively regulates PI3K by the dephosphorylation of PIP3 that lead to PI3K/Akt phosphorylation. PTEN itself becomes phosphorylated and then strongly suppressed by the activation of PI3K/Akt (13). It is suggested that GSE suppresses PTEN phosphorylation and in this way increases its negative regulation on the PI3K pathway (xiv). Induction of PTEN factor expression can inhibit the growth of ovarian cancer cells, stopping their cell cycle in the G1 phase through down- regulation of the PI3K/Akt/mTOR pathway, and inducing the apoptotic process (15). Saito et al. suggested the fundamental roles of the PTEN gene in the development of ovarian tumors (16). PI3K is likewise suppressed by mTOR. mTOR, a downstream cistron in PI3K/Akt pathway, is a serine/threonine-protein kinase that acts through 2 singled-out complexes: mTORC1-raptor and mTORC2-rictor. mTORC1 acts by influencing on pivotal translation-regulating factors. It is believed that the PI3K/Akt/mTOR pathway is a potential predictor of invasiveness in ovarian cancers (17).

Dapper adversary of catenin-i (DACT1) is another tumor suppressor cistron that plays a role in downward-regulating cell cycle and inhibiting cancer prison cell growth by decreasing nuclear β-catenin levels. Expression of DACT1 can inhibit the growth and proliferation of ovarian cancer cells by increasing glycogen synthase kinase 3β (GSK3B) and inhibiting Wnt/β-catenin signaling pathway (18). β-catenin signaling acts every bit an inducer for cell proliferation in different cancers. It is involved in jail cell-prison cell adhesion and Wnt betoken transduction (xix). β-catenin signaling targets cyclinD1 (CCND1) and C-MYC, and mediate the progression of the cell cycle (xx). Cyclin D1 is a protein required for progression through the G1 phase of the cell cycle. C-MYC is a proto-oncogene and a prison cell master regulator. In human colorectal cancer, GSE inhibits cell growth, induces G1 phase prison cell cycle arrest and apoptosis, and modulates jail cell bicycle regulators (21).

At that place are ii main apoptotic pathways including the extrinsic and the intrinsic or mitochondrial pathway (22). Information technology is suggested that GSE induces apoptosis through B-cell lymphoma 2-associated X protein (BAX) and caspase3 (CASP3) pathways (23). The OVCAR-3 is a jail cell line consisting of androgen and estrogen receptors. This prison cell line was established for the kickoff time from the malignant ascites of a patient with progressive adenocarcinoma of the ovary. The cells are histologically similar to the patient's original cells.

The patient has been received a combination of chemotherapy drugs and demonstrated resistance to in vitro clinically relevant concentrations of these drugs. In addition to preference using this cell line let scientists evaluate the effects of other anticancer products on drug resistance in cancer of ovary (24). In this study, nosotros aimed to appraise the furnishings of GSE on chemo-resistant OVCAR-3 in promoting jail cell cycle and apoptosis, and evaluate role of the relevant cellular mechanisms.

MATERIALS AND METHODS

Compounds and reagents

GSE powder was purchased from Sigma (St. Louis, MO, United states) and dissolved in ane mL dimethyl sulfoxide (DMSO); 10 mg/mL stock solution and diluted past Dulbecco's modified eagle medium (DMEM / F12) equally desired concentration. The final concentration of DMSO in the test solutions was less than 0.1% the mixture was heated 30 min in seventy °C, centrifuged ten min at 1800 rpm, and sterilized using a 0.22 μm syringe filter (Milipore, U.s.). It stored at - twenty°C until used. Fetal bovine serum (FBS) and streptomycin-penicillin were procured from (Sigma, The states). PBS, ethanol (95%), and 3-(iv,5 dimethylthiazol- 2yl) -2,5- diphenyltetrazolium bromide (MTT) were from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Jail cell lines and prison cell culture

The ovarian cancer cell line OVCAR-3 was purchased from Pasteur Establish of Iran. All cells were seeded into 25-cm2 flasks with DMEM/F12 medium (Falcon, Grand Island, NY, Us) containing 10% FBS supplemented with 1% penicillin and streptomycin and incubated at 37 °C, 95% humidity, and 5% CO2. At 80% confluency, cells were trypsinized and incubated for downstream experiments. OVCAR-3 cells were passaged every 2-3 days.

Experimental groups

OVCAR-3 cells were assigned into six groups including 1 and two control groups (cells in normal condition with no handling for 24 and 48 h); 3 and 4 DMSO groups, cells treated with DMSO as solvent of GSE for 24 and 48 h; and five and half dozen GSE groups, cells treated with GSE at IC50 (71 μg/mL) for 24 and 48 h.

The IC50, the concentration of GSE that inhibits one-half-maximal proliferation of OVCAR-3 cells, were determined as follows: 10,000 cells per well were seeded in 96-well plates and incubated overnight. Then cells were treated with a 200 μL serial dilution of GSE (10 to 250 μg/mL) for 24 h. Assays included bare wells containing medium only, untreated control cells, and test cells treated with GSE at different concentrations. Afterwards, cells got through MTT assay to determine the cell viability rate. IC50 curve and then were drawn.

MTT assay and determination of cell viability assays

The cytotoxicity outcome of GSE was determined by MTT assay. Ten thou cells per well were seeded in 96-well plates and incubated overnight. Next, cells were treated with GSE and DMSO for 24 and 48 h. For controls, the cells were incubated simply with the medium. Each group was repeated in 6 wells. At the cease of treatment, the cell viability charge per unit was evaluated by MTT assay. The absorbance in each well was measured at 570 nm wavelength in a microtiter plate reader (Hiperion, Deutschland). The reference wavelength was higher than 650 nm. The blanks were given values close to cypher (± 0.1).

Apoptosis analysis by menses cytometry

OVCAR-3 cells were seeded into half-dozen-well culture plates and treated for 24 and 48 h. Annexin Five and Propidium iodide (PI) staining were performed followed by flow cytometry. The cells were trypsinized and washed with PBS. After adding the binding buffer, the cells were treated with 5 μL of annexin 5-fluorescein isothiocyanate (FITC). Cells were incubated at room temperature for 15 min and then washed with washing buffer. Finally, 200 μL buffer and 5 μL PI were added to the cells and apoptotic OVCAR-iii cells were counted by flow cytometry (Becton Dickinson, Heidelberg, Federal republic of germany) (25).

CASP3 activity assay

CASP3/CPP32 fluorometric analysis kit (BioVision, Catalog # K105-25, USA) was utilized to evaluate the activity of CASP3. At the finish of treatment, cells were trypsinized and done with PBS. The pellet of cells suspended in l μL of chilled cell lysis buffer. Then 50 μL of ii× reaction buffer (containing 10 mM DTT) added to each sample. Next, cells were incubated on ice for ten min. Subsequently, l μL of 2× reaction buffer, one μL of dithiothreitol (DTT, 1 M), and five μL of DEVD-AFC (i mM) were added to the cell lysates.

The reactions were incubated for ii h at 37 °C, v% CO2, and 95% humidity. Finally, l μL of cell lysates were transferred into a 96 well plate and the absorbance was read using a fluorometric spectrophotometer (Multiple Reader Synergy H1, USA) with 400 nm excitation and 505 nm emission filters.

Evaluation of genes' expression

The expression level of the genes of interest in this study was determined past real-time polymerase concatenation reaction (RT-PCR). Total RNA from the cells of different handling groups was extracted using the YTA Total RNA Purification Mini kit (Yekta Tajhiz Azma, I.R. Islamic republic of iran) according to the manufacturer protocol. After treatment with DNase I to remove genomic Deoxyribonucleic acid, cDNA was reverse transcript using Revert Aid ™ Beginning Strand cDNA Synthesis Kit (Fermentas, USA).

Maxima SYBR Greenish ROX qPCR Master Mix kit (Fermentas, Us) used according to the manufacturer's protocol in an ABI Step I Plus™ Existent-Time PCR System (Practical Biosystems, USA). The cycling parameters were equally follows: 10 min at 95 °C for initial denaturation, followed by 40 cycles of denaturation stride at 95 °C for 15 s and annealing/extension for ane min at 60 °C. β-actin (ACTB) was used as a reference cistron for internal control. Data were analyzed by the comparative Ct (ΔΔct) method. These experiments were carried out in triplicate and were independently repeated at least 3 times (26). Cistron-specific primer sequences are presented in Tabular array i.

Table 1

Listing of primers used in this report.

Genes Frontwards sequence Reverse sequence
PTEN ACCAGTGGCACTGTTGTTTC TCCTCTGGTCCTGGTATGAAG
DACT1 CCCCAAATCTGCAGATGTG TGACGGCATCTAGCTCAGATC
AKT TCTTTGCCGGTATCGTGT TGTCATCTTGGTCAGGTGGT
MTOR TCCGAGAGATGAGTCAAGAGG TCCCACCTTCCACTCCTATG
GSK3β TGTCAAGTTGTATATGTATCAGC AATACAGCAGTATCAGGATCC
C-MYC GCGACTCTGAGGAGGAACAAG TCCAGACTCTGACCTTTTGCC
CDK4 TCTTTGACCTGATTGGGCTG CCATCTCAGGTACCACCGAC
CCND1 ACAAACAGATCATCCGCAAACAC TGTTGGGGCTCCTCAGGTTC
BAX GGAGCTGCAGAGGATGATTG GTCCAATGTCCAGCCCATG
BCL2 AAAATACAACATCACAGAGGAAG CTTGATTCTGGTGTTTCCC
CASP3 AGCACTGGAATGACATCTCG ACATCACGCATCAATTCCAC
CASP8 ACTGGATGATGACATGAACCTG GCTGAATTCTTCATAGTCGTTG
CASP9 CCTTTGTTCATCTCCTGCTTAG CCTCAAACTCTCAAGAGCACC
β-actin TTCGAGCAAGAGATGGCCA CACAGGACTCCATGCCCAG

Statistical analysis

All experiments were repeated three times and the information are expressed equally mean ± SD. Comparing between groups was done using One-way ANOVA test followed by Mail service hoc Tukey test and P values < 0.05 were considered significant. All data were statistically analyzed by SPSS software version 23.0.

RESULTS

Cytotoxicity issue of grape seed extract

The treated cells evaluated by MTT assay to determine the jail cell viability rate and IC50 curve were drawn according to the obtained results. Based on the depicted curve, the concentration of 71 μg/mL corresponded to fifty% cell viability of the OVCAR-three cells post-obit treatment with GSE and was considered every bit IC50 of GSE in this study (Fig. 1A).

An external file that holds a picture, illustration, etc.  Object name is RPS-15-390-g001.jpg

(A) The Effect of GSE on the viability of OVCAR-3 cells. The cells were incubated with different concentrations (ten-250 ug/mL) of GSE for 24 h. Prison cell viability was measured with MTT assay. Based on the results, IC50 of GSE was in the range of 71 μg/mL; (B) issue of different treatments on OVCAR-3 cells viability.***P < 0.001 indicates significant differences compared to the corresponding DMSO grouping GSE, Grape seed extract; DMSO, dimethyl sulfoxide.

Inhibition of OVCAR-3 jail cell growth by grape seed excerpt

GSE significantly (P < 0.001) decreased the viability of the cells subsequently 24 h (l.01 ± 2.75%) and 48 h (43.04 ± 1.91%) (Fig. 1B).

Annexin V assay and flow cytometry

Every bit shown in Figs. ​ two and ​ 3, compared to the DMSO-treated cells, the rate of apoptotic cells afterwards 24 h of treatment with GSE at 71 μg/mL was 39.iv ± 3.one% and for 48 h was 46.4 ± 3.v% (P < 0.001).

An external file that holds a picture, illustration, etc.  Object name is RPS-15-390-g002.jpg

The effects of GSE on cell apoptosis was adamant by flow cytometry. Handling with GSE at 71 μg/mL for 24 and 48 h, significantly induced apoptosis in OVCAR-3 cells compared with the DMSO treated cells. (A and B) Command, cells without treatment with any substance in 24 and 48h respectively; (C and D) cells treated with DMSO as solvent of GSE for 24 and 48 h, respectively; and (E and F) cells treated with GSE at 71 μg/mL for 24 and 48 h, respectively. P < 0.001 indicates significant differences compared to the respective DMSO group GSE, Grape seed extract; DMSO, dimethyl sulfoxide

An external file that holds a picture, illustration, etc.  Object name is RPS-15-390-g003.jpg

The result of GSE on the apoptotic cell in different groups evaluated by catamenia cytometry. P < 0.001 indicates pregnant differences compared to the corresponding DMSO group GSE, Grape seed extract; DMSO, dimethyl sulfoxide.

CASP3 activity assay

The protein expression of CASP3 in the OVCAR-3 cells was measured to ensure cell expiry with apoptosis. Caspase colorimetric assay indicated that the protein expression levels of CASP3 in the GSE-treated groups compared to the DMSO-treated grouping was increased significantly (P < 0.001). However, the difference betwixt the GSE-treated groups was non significant at unlike times (Fig. 4).

An external file that holds a picture, illustration, etc.  Object name is RPS-15-390-g004.jpg

Poly peptide expression of caspase3 in dissimilar groups evaluated by caspase colorimetric. ***P < 0.001 indicates significant differences compared to the corresponding DMSO group GSE, Grape seed extract; DMSO, dimethyl sulfoxide.

RT-PCR

RT-PCR was used to evaluate the effects of GSE on the expression level of genes involved in jail cell bicycle and apoptosis process. The result showed that treatment with GSE at IC50 increases the expression level of PTEN and DACT1 tumor suppressor genes and consequently affected the expression level of downstream genes such equally AKT, MTOR, GSK3B and C-MYC that involved in jail cell growth and proliferation (P < 0.001, Fig. ​ 5A and ​ B). Genes involved in cell cycle including CCND1, cyclin-dependent kinase4 (CDK4) were significantly decreased following GSE treatment in OVCAR-3 cells compared to their respective control cells (P < 0.001, (Fig. 5C).

An external file that holds a picture, illustration, etc.  Object name is RPS-15-390-g005.jpg

The effects of GSE on the expression level of genes involved in the signaling pathway, prison cell bike, and apoptosis process evaluated past real-time polymerase chain reaction. (A) The expression level of genes involved in PI3K/ AKT/mTOR signaling pathway (PTEN, AKT, and mTOR) in dissimilar groups; (B) the expression level of genes involved in Wnt/ β-catenin signaling pathway (DACT1, GSK3B, and C-MYC) in different groups; (C) the expression level of genes involved in the prison cell cycle (CDK4 and CCND1) in different groups; (D) the expression level of pro- and anti-apoptotic genes (BAX and BCL2) in dissimilar groups; (Due east) The expression level of genes involved in the apoptotic process(CASP3, CASP8, and CASP9) in different groups. *P < 0.001 indicates meaning differences compared to the corresponding DMSO group GSE, Grape seed extract; DMSO, dimethyl sulfoxide; PI3K, phosphoinositide three-kinases; AKT, protein kinase B; mTOR, mammalian target of rapamycin; PTEN, phosphatase and tensin homologue; DACT1, dapper antagonist of catenin-one; GSK3B, glycogen synthase kinase 3β; CDK4, cyclin dependent kinase4; CCND1,catenin signaling targets cyclinD1; BAX, B-cell lymphoma 2-associated X protein, BCL2, B-prison cell lymphoma 2; CASP3, caspase3.

The result indicated that GSE up-regulates the expression of BAX pro-apoptotic cistron and down-regulates the expression of BCL2 anti- apoptotic gene (P < 0.001, Fig. 5D). Also showed that treatment with GSE leads to increase expression of CASP genes involved in the intrinsic and extrinsic apoptotic pathway (P < 0.001, Fig. 5E).

Word

This research aimed at evaluating the biological effects of GSE on OVCAR-three, an ovarian cancer chemo-resistant jail cell line. To achieve this aim, we evaluated the effects of GSE on one of the most investigated intracellular signaling pathway, the PI3K/AKT/MTOR (27). Given the aberrant activation of PI3K/AKT/MTOR in some cancers and the involvement of the PTEN tumor suppressor gene in the PI3K/AKT/MTOR signaling pathway, we investigated the alteration of PTEN expression in OVCAR-3 ovarian cancer cell line to evaluate its role in tumorigenesis.

PTEN is a tumor suppressor gene that its inactivation in some cancer cell lines is associated with increasing the PI3k/AKT pathway activity (28). According to the reports, GSE induces the inhibitory effect of PTEN on the PI3K/AkT pathway in colon cancer prison cell lines (29). Barbe et al. concluded that anticancer effects of GSE is due to increasing of reactive oxygen specious by down- regulation of several molecular pathways including PI3K/AKT, MAPK Kinas, and NF- KB (30).

In one study conducted past Takaei et al. the overexpression of PTEN in ovarian cancer cells suppressed the growth of tumors and increased survival time in mice with the peritoneal disseminated tumor (fifteen). Another study demonstrated that loss of PTEN in murine oviductal cells resulted in the invasion of cancerous cells to the ovary and induced hyperplasia and tumor formation in the ovary (31). Saito et al. suggested that the PTEN gene has a principal function in the evolution of ovarian tumors (16).

In our study, we figured out that treatment of the OVCAR-iii ovarian cancer cells with GSE leads to the induction of PTEN expression as well as reduction of the levels of AKT and MTOR genes, the components of the PI3K/AKT/MTOR signaling pathway. The meaning reduction in cell growth and proliferation was seen post-obit handling with GSE, which can be attributed to the overexpression of PTEN and its inhibitory effect on the PI3K/AKT/MTOR signaling pathway.

Some other tumor suppressor gene which plays an of import role in inhibiting ovarian cancer cell proliferation and provoking apoptosis is DACT1. DACT1 regulates the cell cycle and inhibits cancer cell growth by decreasing nuclear β-catenin levels. It was reported that aberrant activation of Wnt/β-catenin pathway in ovarian cancer leads to the hyperactivity of β-catenin (32). Li et al. suggested that overexpression of DACT1 in type i epithelial ovarian cancer, reduced its expansion and cis- platinum resistance by controlling canonical Wnt signaling and autophagy (18).

In our study we concluded that GSE induced the upregulation of DACT1 in OVCAR-3 cells that is in agreement with the results of the abovementioned studies. Several reports showed that GSK3B was frequently phosphorylated and inactivated in epithelial ovarian cancer (33). Information technology has been determined overexpression of DACT1 by enhancing the activity of GSK-3β reduced the level of nuclear β-catenin and as well the Wnt/β-catenin target genes such every bit C-MYC (eighteen). Activation of GSK3B suppresses tumorigenesis by downwardly- regulation of CCND1 expression and cell cycle arrest in chest cancer cells (34). Based on the results of the nowadays study we ended that administration of GSE leads to the upregulation of DACT1 and GSK3B genes and downregulation of C-MYC gene. This may indicate the anterior effects of GSE on Wnt signaling pathway and its subsequent influences on C-MYC expression. Hence, inhibiting Wnt signaling pathway may subtract the resistance of cancer cells to chemotherapy.

It has long been suggested that C-MYC distension is a mutual finding in advanced stages of ovarian cancer (13). It also has been recently proven that MYC condition is a determinant of synergetic drug response in ovarian cancer (35). The expression of CDK4 and CCND1 genes also were assessed in the present written report. It was reported that in advanced serous epithelial ovarian cancer, overexpression of CCND1 led to a poor prognosis (11).

CDK4 gene has an important part in the cell cycle. Several preclinical studies have shown that CCND1-CDK4/6 is a necessary factor for maintaining the tumorigenic potential of cancer cells (35). It has been suggested that GSE induces apoptosis in float cancer cells by decreasing the expression of CCND1 and CDK4 (36). In agreement with these findings, the results of our study showed that treatment of OVCAR-3 cells with GSE resulted in a significant reduction in the expression levels of CCND1 also equally CDK4, 24, and 48 h after treatment.

To study the effects of GSE on the apoptotic pathway, the expression of CASP8 and 9 likewise as CASP3 were evaluated. Agraval et al. suggested that in prostatic cancer GSE induces apoptosis via activation of caspases in companion with the devastation of mitochondrial membrane and releasing cytochrome C (37). In another study it was shown that anticancer effects of GSE in colon cancer are associated with differential modulation of pro- and anti- apoptotic proteins (x).

In our report, the meaning overexpression levels of CASP8 and 9 equally well as CASP3 genes were observed 24 and 48 h afterwards treatment with GSE. In addition, CASP3 assay confirmed the overexpression of CASP3 protein following treatment with GSE. Information technology is believed that enhancement in the BAX/BCL2 ratio is indicative of the initiation of the mitochondrial pathway apoptosis (35). It was reported GSE promotes its pro-apoptotic effects on colon cancer cells by reducing AKT and thereby inhibiting its effects on BAD and BCL2 (38). In line with these findings, the results of this study also indicated an increase in the BAX/BCL2 expression ratio. Also, information technology was suggested that treatment with BCL2 inhibitors improved the response to cisplatin in preclinical models of ovarian cancer studies (3). The results of our study demonstrated that the expression of CASP8 and 9, and CASP3 increased significantly compared to the control groups. The expression of CASP3 gene also confirmed by CASP3 protein analysis. This may propose that GSE exerts its apoptotic effects on OVCAR-three cells past activating both intrinsic and extrinsic pathways.

CONCLUSION

Overall, the results of this written report showed that the treatment of OVCAR-iii ovarian cancer cells with GSE led to a reduction in prison cell growth and proliferation and induction of apoptosis process. GSE may render its anti-proliferative effects by provoking the augmentation of the PTEN and DACT1 genes expression and its subsequent effects on inhibition of PI3K/AKT/MTOR and Wnt/βcatenin signaling pathway. Also, GSE may exert its apoptotic effects on ovarian cancer cells past promoting both intrinsic and extrinsic apoptotic pathways.

CONFLICT OF Involvement STATEMENT

The authors declare no conflict of interest in this study.

AUTHORS' CONTRIBUTION

M. Homayoun contributed to the blueprint, experimental studies, information assay, and manuscript preparation. R. Ghasemnezhad Targhi assisted in data analysis, preparation, and editing of manuscript. M. Soleimani contributed to the concept, written report blueprint, manuscript grooming and revision.

ACKNOWLEDGMENTS

This research was financially supported by the Vice-Chancellery of Research of Isfahan University of Medical Sciences, Isfahan, I.R. Iran through the Grant No. 397361.

REFERENCES

1. Torre LA, Trabert B, DeSantis CE, Miller KD, Samimi G, Runowicz CD, et al. Ovarian cancer statistics, 2018. CA Cancer J Clin. 2018;68(4):284–296. DOI: 10.3322/caac.21456. [PMC free article] [PubMed] [Google Scholar]

2. Pokhriyal R, Hariprasad R, Kumar L, Hariprasad G. Chemotherapy resistance in advanced ovarian cancer patients. Biomark Cancer. 2019;11:1–19. DOI: x.1177/1179299X19860815. [PMC costless article] [PubMed] [Google Scholar]

3. Chandra A, Pius C, Nabeel 1000, Nair M, Vishwanatha JK, Ahmad S, et al. Ovarian cancer: current status and strategies for improving therapeutic outcomes. Cancer Med. 2019;8(16):7018–7031. DOI: 10.1002/cam4.2560. [PMC gratuitous article] [PubMed] [Google Scholar]

iv. Homayoun K, Seghatoleslam M, Pourzaki Yard, Shafieian R, Hosseini M, Bideskan AE. Anticonvulsant and neuroprotective effects of Rosa damascena hydro-alcoholic extract on rat hippocampus. Avicenna J Phytomed. 2015;v(3):260–270. [PMC free article] [PubMed] [Google Scholar]

5. Wang P, Yang HL, Yang YJ, Wang L, Lee SC. Overcome cancer cell drug resistance using natural products. Evid Based Complement Alternat Med. 2015;2015:767136,i–14. DOI: x.1155/2015/767136. [PMC free article] [PubMed] [Google Scholar]

vi. Dinicola S, Cucina A, Antonacci D, Bizzarri G. Anticancer effects of grape seed extract on human cancers: a review. J Carcinog Mutagen. 2014;S8:1–14. DOI: 104172/2157-2518S8-005. [Google Scholar]

7. Shi J, Yu J, Pohorly JE, Kakuda Y. Polyphenolics in grape seeds-biochemistry and functionality. J Med Nutrient. 2003;vi(4):291–299. DOI: 10.1089/109662003772519831. [PubMed] [Google Scholar]

eight. Yen CY, Hou MF, Yang ZW, Tang JY, Li KT, Huang HW, et al. Concentration furnishings of grape seed extracts in anti-oral cancer cells involving differential apoptosis, oxidative stress, and DNA damage. BMC Complement Altern Med. 2015;fifteen:94–102. DOI: ten.1186/s12906-015-0621-viii. [PMC costless commodity] [PubMed] [Google Scholar]

9. Kaur M, Agarwal C, Agarwal R. Anticancer and cancer chemopreventive potential of grape seed extract and other grape-based products. J Nutr. 2009;139(nine):1806S–1812S. DOI: 10.3945/jn.109.106864. [PMC free article] [PubMed] [Google Scholar]

10. Derry 1000, Raina K, Agarwal R, Agarwal C. Differential effects of grape seed extract against homo colorectal cancer prison cell lines: the intricate office of decease receptors and mitochondria. Cancer Lett. 2013;334(1):69–78. DOI: 10.1016/j.canlet.2012.12.015. [PMC free article] [PubMed] [Google Scholar]

11. Hashimoto T, Yanaihara N, Okamoto A, Nikaido T, Saito Thousand, Takakura S, et al. Cyclin D1 predicts the prognosis of advanced serous ovarian cancer. Exp Ther Med. 2011;two(2):213–219. DOI: ten.3892/etm.2011.194. [PMC free article] [PubMed] [Google Scholar]

12. Cheaib B, Auguste A, Leary A. The PI3K/Akt/mTOR pathway in ovarian cancer: therapeutic opportunities and challenges. Chin J Cancer. 2015;34(ane):4–16. DOI: ten.5732/cjc.014.10289. [PMC gratuitous article] [PubMed] [Google Scholar]

13. Chalhoub Northward, Bakery SJ. PTEN and the PI3-kinase pathway in cancer. Annu Rev Pathol. 2009;4:127–150. DOI: 10.1146/annurev.pathol.4.110807.092311. [PMC complimentary article] [PubMed] [Google Scholar]

fourteen. Engelbrecht AM, Mattheyse Thousand, Ellis B, Loos B, Thomas M, Smith R, et al. Proanthocyanidin from grape seeds inactivates the PI3-kinase/PKB pathway and induces apoptosis in a colon cancer cell line. Cancer Lett. 2007;258(1):144–153. DOI: 10.1016/j.canlet.2007.08.020. [PubMed] [Google Scholar]

fifteen. Takei Y, Saga Y, Mizukami H, Takayama T, Ohwada M, Ozawa Chiliad, et al. Overexpression of PTEN in ovarian cancer cells suppresses ip dissemination and extends survival in mice. Mol Cancer Ther. 2008;7(3):704–711. DOI: 101158/1535-7163MCT-06-0724. [PubMed] [Google Scholar]

sixteen. Saito 1000, Okamoto A, Kohno T, Takakura South, Shinozaki H, Isonishi S, et al. Allelic imbalance and mutations of the PTEN gene in ovarian cancer. Int J Cancer. 2000;85(2):160–165. [PubMed] [Google Scholar]

17. Gasparri ML, Bardhi East, Ruscito I, Papadia A, Farooqi AA, Marchetti C, et al. PI3K/AKT/mTOR pathway in ovarian cancer treatment: are we on the right runway. Geburtshilfe Frauenheilkd. 2017;77(10):1095–1103. DOI: x.1055/s-0043-118907. [PMC free article] [PubMed] [Google Scholar]

18. Li RN, Liu B, Li XM, Hou LS, Mu XL, Wang H, et al. DACT1 Overexpression in type I ovarian cancer inhibits malignant expansion and cis-platinum resistance by modulating canonical Wnt signalling and autophagy. Sci Rep. 2017;7(1):9285–9296. DOI: 10.1038/s41598-017-08249-7. [PMC free commodity] [PubMed] [Google Scholar]

nineteen. Olmeda D, Castel S, Vilaró S, Cano A. β-Catenin regulation during the jail cell bike: implications in G2/M and apoptosis. Mol Biol Prison cell. 2003;14(7):2844–2860. DOI: 10.1091/mbc.e03-01-0865. [PMC free article] [PubMed] [Google Scholar]

xx. Velmurugan B, Singh RP, Kaul Northward, Agarwal R, Agarwal C. Dietary feeding of grape seed excerpt prevents intestinal tumorigenesis in APCmin/+mice. Neoplasia. 2010;12(1):95–102. DOI: 10.1593/neo.91718. [PMC gratuitous article] [PubMed] [Google Scholar]

21. Gao N, Budhraja A, Cheng S, Yao H, Zhang Z, Shi Ten. Consecration of apoptosis in human leukemia cells past grape seed extract occurs via activation of JKN. Clin Cancer Res. 2009;xv(1):140–149. DOI: 10.1158/1078-0432.CCR-08-1447. [PMC free article] [PubMed] [Google Scholar]

22. Kruidering M, Evan GI. Caspase-viii in apoptosis: the outset of "the end" IUBMB life. 2000;50(ii):85–90. DOI: ten.1080/713803693. [PubMed] [Google Scholar]

23. Roy AM, Baliga MS, Elmets CA, Katiyar SK. Grape seed proanthocyanidins induce apoptosis through p53, Bax, and caspase three pathways. Neoplasia. 2005;7(i):24–36. DOI: x.1593/neo.04412. [PMC free commodity] [PubMed] [Google Scholar]

24. Wang 50, Mezencev R, Bowen NJ, Matyunina LV, McDonald JF. Isolation and characterization of stem-like cells from a human being ovarian cancer cell line. Mol Cell Biochem. 2012;363(one-2):257–268. DOI: ten.1007/s11010-011-1178-6. [PubMed] [Google Scholar]

25. Schutte B, Nuydens R, Geerts H, Ramaekers F. Annexin V bounden assay as a tool to measure apoptosis in differentiated neuronal cells. J Neurosci Methods. 1998;86(ane):63–69. DOI: ten.1016/s0165-0270(98)00147-2. [PubMed] [Google Scholar]

26. Liu J, Zhang W, Kong ZH, Ding DG. Induction of cell cycle arrest and apoptosis by grape seed procyanidin excerpt in human bladder cancer BIU87 cells. Eur Rev Med Pharmacol Sci. 2016;20(15):3282–3291. [PubMed] [Google Scholar]

27. Porta C, Paglino C, Mosca A. Targeting PI3K/Akt/mTOR signaling in cancer. Front Oncol. 2014;4:64–74. DOI: 10.3389/fonc.2014.00064. [PMC free article] [PubMed] [Google Scholar]

28. Nero C, Ciccarone F, Pietragalla A, Scambia G. PTEN and gynecological cancers. Cancers (Basel) 2019;11(ten):1458–1474. DOI: 10.3390/cancers11101458. [PMC free article] [PubMed] [Google Scholar]

29. Milella One thousand, Falcone I, Conciatori F, Cesta Incani U, Del Curatolo A, Inzerilli N, et al. PTEN: multiple functions in human malignant tumors. Forepart Oncol. 2015;5:24–37. DOI: x.3389/fonc.2015.00024. [PMC free article] [PubMed] [Google Scholar]

xxx. Barbe A, Ramé C, Mellouk Due north, Estienne A, Bongrani A, Brossaud A, et al. Effects of grape seed extract and proanthocyanidin b2 on in vitro proliferation, viability, steroidogenesis, oxidative stress, and cell signaling in human being granulosa cells. Int J Mol Sci. 2019;20(17):4215–4235. DOI: ten.3390/ijms20174215. [PMC gratuitous article] [PubMed] [Google Scholar]

31. Russo A, Czarnecki AA, Dean M, Modi DA, Lantvit DD, Hardy L, et al. PTEN loss in the fallopian tube induces hyperplasia and ovarian tumor formation. Oncogene. 2018;37(15):1976–1990. DOI: 10.1038/s41388-017-0097-eight. [PMC free article] [PubMed] [Google Scholar]

32. Nguyen VHL, Hough R, Bernaudo S, Peng C. Wnt/β-catenin signalling in ovarian cancer: insights into its hyperactivation and function in tumorigenesis. J Ovarian Res. 2019;12(1):122–138. DOI: 10.1186/s13048-019-0596-z. [PMC complimentary article] [PubMed] [Google Scholar]

33. Arend RC, Londoño-Joshi AI, Straughn JM, Jr, Buchsbaum DJ. The Wnt/β-catenin pathway in ovarian cancer: a review. Gynecol Oncol. 2013;131(3):772–779. DOI: x.1016/j.ygyno.2013.09.034. [PubMed] [Google Scholar]

34. Luo J. Glycogen synthase kinase 3β (GSK3β) in tumorigenesis and cancer chemotherapy. Cancer lett. 2009;273(2):194–200. DOI: 10.1016/j.canlet.2008.05.045. [PMC complimentary article] [PubMed] [Google Scholar]

35. Niu Y, Xu J, Sun T. Cyclin-dependent kinases 4/6 inhibitors in chest cancer: current status, resistance, and combination strategies. J Cancer. 2019;10(22):5504–5517. DOI: 10.7150/jca.32628. [PMC complimentary article] [PubMed] [Google Scholar]

36. Raina 1000, Tyagi A, Kumar D, Agarwal R, Agarwal C. Role of oxidative stress in cytotoxicity of grape seed extract in human bladder cancer cells. Food Chem Toxicol. 2013;61:187–195. DOI: ten.1016/j.fct.2013.06.039. [PMC free article] [PubMed] [Google Scholar]

37. Agarwal C, Singh RP, Agarwal R. Grape seed extract induces apoptotic death of human prostate carcinoma DU145 cells via caspases activation accompanied by dissipation of mitochondrial membrane potential and cytochrome c release. Carcinogenesis. 2002;23(11):1869–1876. DOI: 10.1093/carcin/23.xi.1869. [PubMed] [Google Scholar]

38. Zhang R, Yu Q, Lu W, Shen J, Zhou D, Wang Y, et al. Grape seed procyanidin B2 promotes the autophagy and apoptosis in colorectal cancer cells via regulating PI3K/Akt signaling pathway. Onco Targets Ther. 2019;12:4109–4118. DOI: 10.2147/OTT.S195615. [PMC gratuitous commodity] [PubMed] [Google Scholar]


Articles from Inquiry in Pharmaceutical Sciences are provided here courtesy of Wolters Kluwer -- Medknow Publications


moskowitzsorpathey83.blogspot.com

Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7714018/

0 Response to "Anticancer Effects of Grape Seed Extract on Human Cancers a Review"

Enregistrer un commentaire

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel